About
These samples were sequenced on a mix of Illumina NextSeq2000 and NovaSeq platforms. The data was processed using the OceanOmics pipeline, which includes demultiplexing, quality control, denoising via DADA2, curation via LULU, and taxonomic assignment via BLAST and an LCA step. The pipeline is available on GitHub.
Primers used
| Primer name | Primer sequence Forward | Primer sequence Reverse | Citation |
|---|---|---|---|
| 12S Miya | GTCGGTAAAACTCGTGCCAGC | CATAGTGGGGTATCTAATCCCAGTTTG | Miya, M., Gotoh, R. O., & Sado, T. (2020). MiFish metabarcoding: a high-throughput approach for simultaneous detection of multiple fish species from environmental DNA and other samples. Fisheries Science, 86(6), 939-970. |
| 16S Berry | GACCCTATGGAGCTTTAGAC | CGCTGTTATCCCTADRGTAACT | Berry, T. E., Osterrieder, S. K., Murray, D. C., Coghlan, M. L., Richardson, A. J., Grealy, A. K., Stat, M., Bejder, L., & Bunce, M. (2017). DNA metabarcoding for diet analysis and biodiversity: A case study using the endangered Australian sea lion (Neophoca cinerea). Ecology and evolution, 7(14), 5435-5453. |
Changelog
Version 1.0
- Initial release: contains data from the following voyages: Rowley Shoals (Aug 21), Rowley Shoals (Oct 19), Montebello (Aug 21), Montebello (Feb 21), Rowley Shoals (Feb 21), Perth Canyon, Abrolhos 2023, Abrolhos 2022, Great Barrier Reef, Abrolhos 2021, Cocos Keeling Islands (Project III), Cocos Keeling Islands (Project II), Cocos Keeling Islands (Project I), and South West WA (2022).
- Initial design of the map, and initial design of Ocean Genomes dashboard.
- State of Ocean Genomes data: June 7th, 2024.